Skip to main content

pLKO.1-Teton-puro-shFAK #1
(Plasmid #198757)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198757 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1-Teton-puromycin
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shFAK #1
  • gRNA/shRNA sequence
    CCGGGATGTTGGTTTAAAGCGATTTCTCGAGAAATCGCTTTAAACCAACATCTTTTTG
  • Species
    H. sapiens (human)
  • Entrez Gene
    PTK2 (a.k.a. FADK, FADK 1, FAK, FAK1, FRNK, PPP1R71, p125FAK, pp125FAK)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-Teton-puro-shFAK #1 was a gift from Hyonchol Jang (Addgene plasmid # 198757 ; http://n2t.net/addgene:198757 ; RRID:Addgene_198757)
  • For your References section:

    FAK-Copy-Gain Is a Predictive Marker for Sensitivity to FAK Inhibition in Breast Cancer. Kim YH, Kim HK, Kim HY, Gawk H, Bae SH, Sim HW, Kang EK, Seoh JY, Jang H, Hong KM. Cancers (Basel). 2019 Sep 2;11(9). pii: cancers11091288. doi: 10.3390/cancers11091288. 10.3390/cancers11091288 PubMed 31480645