pLKO.1-Teton-puro-shFAK #2
(Plasmid
#198758)
-
Purposeconditional knockdown of FAK
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1-Teton-puromycin
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshFAK #2
-
gRNA/shRNA sequenceCCGGCCGGTCGAATGATAAGGTGTACTCGAGTACACCTTATCATTCGACCGGTTTTTG
-
SpeciesH. sapiens (human)
-
Entrez GenePTK2 (a.k.a. FADK, FADK 1, FAK, FAK1, FRNK, PPP1R71, p125FAK, pp125FAK)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-Teton-puro-shFAK #2 was a gift from Hyonchol Jang (Addgene plasmid # 198758 ; http://n2t.net/addgene:198758 ; RRID:Addgene_198758) -
For your References section:
FAK-Copy-Gain Is a Predictive Marker for Sensitivity to FAK Inhibition in Breast Cancer. Kim YH, Kim HK, Kim HY, Gawk H, Bae SH, Sim HW, Kang EK, Seoh JY, Jang H, Hong KM. Cancers (Basel). 2019 Sep 2;11(9). pii: cancers11091288. doi: 10.3390/cancers11091288. 10.3390/cancers11091288 PubMed 31480645