Skip to main content

pLKO.1-Teton-puro-shFDPS #1
(Plasmid #198759)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198759 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1-Teton-puromycin
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shFDPS #1
  • gRNA/shRNA sequence
    CCGGCCAGCAGTGTTCTTGCAATATCTCGAGATATTGCAAGAACACTGCTGGTTTTTG
  • Species
    H. sapiens (human)
  • Entrez Gene
    FDPS (a.k.a. FPPS, FPS, POROK9)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-Teton-puro-shFDPS #1 was a gift from Hyonchol Jang (Addgene plasmid # 198759 ; http://n2t.net/addgene:198759 ; RRID:Addgene_198759)
  • For your References section:

    Farnesyl diphosphate synthase is important for the maintenance of glioblastoma stemness. Kim HY, Kim DK, Bae SH, Gwak H, Jeon JH, Kim JK, Lee BI, You HJ, Shin DH, Kim YH, Kim SY, Han SS, Shim JK, Lee JH, Kang SG, Jang H. Exp Mol Med. 2018 Oct 17;50(10):137. doi: 10.1038/s12276-018-0166-2. 10.1038/s12276-018-0166-2 PubMed 30333528