Skip to main content
Addgene

pcDNA 3.1 - circMAN2A1
(Plasmid #198837)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198837 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 6004
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    circular mannosidase alpha class 2A member 1
  • Alt name
    circMAN2A1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    400
  • Mutation
    circular RNA composed by 2 exons
  • GenBank ID
    NM_002372.4
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aagggaaatgattcaggac
  • 3′ sequencing primer aaaagtcattagtacgtacctttac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA 3.1 - circMAN2A1 was a gift from Stefan Stamm (Addgene plasmid # 198837 ; http://n2t.net/addgene:198837 ; RRID:Addgene_198837)
  • For your References section:

    Alzheimer's disease pathogenetic progression is associated with changes in regulated retained introns and editing of circular RNAs. Arizaca Maquera KA, Welden JR, Margvelani G, Miranda Sardon SC, Hart S, Robil N, Hernandez AG, de la Grange P, Nelson PT, Stamm S. Front Mol Neurosci. 2023 May 5;16:1141079. doi: 10.3389/fnmol.2023.1141079. eCollection 2023. 10.3389/fnmol.2023.1141079 PubMed 37266374