pcDNA 3.1 - circMAN2A1
(Plasmid
#198837)
-
PurposeThis contains the 400nt isoform of exons two and three from MAN2A1 circular RNA, 3X Flag tag inserted in exon two
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6004
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecircular mannosidase alpha class 2A member 1
-
Alt namecircMAN2A1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)400
-
Mutationcircular RNA composed by 2 exons
-
GenBank IDNM_002372.4
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aagggaaatgattcaggac
- 3′ sequencing primer aaaagtcattagtacgtacctttac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA 3.1 - circMAN2A1 was a gift from Stefan Stamm (Addgene plasmid # 198837 ; http://n2t.net/addgene:198837 ; RRID:Addgene_198837) -
For your References section:
Alzheimer's disease pathogenetic progression is associated with changes in regulated retained introns and editing of circular RNAs. Arizaca Maquera KA, Welden JR, Margvelani G, Miranda Sardon SC, Hart S, Robil N, Hernandez AG, de la Grange P, Nelson PT, Stamm S. Front Mol Neurosci. 2023 May 5;16:1141079. doi: 10.3389/fnmol.2023.1141079. eCollection 2023. 10.3389/fnmol.2023.1141079 PubMed 37266374