pcDNA 3.1 - circMAN2A1
(Plasmid #198837)

• Purpose: This contains the 400nt isoform of exons two and three from MAN2A1 circular RNA, 3X Flag tag inserted in exon two
• Depositing Lab: Stefan Stamm
• Publication: Arizaca Maquera et al Front Mol Neurosci. 2023 May 5;16:1141079. doi: 10.3389/fnmol.2023.1141079. eCollection 2023.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 6004
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: circular mannosidase alpha class 2A member 1
• Alt name: circMAN2A1
• Species: H. sapiens (human)
• Insert Size (bp): 400
• Mutation: circular RNA composed by 2 exons
• GenBank ID: NM_002372.4
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aagggaaatgattcaggac
• 3′ sequencing primer: aaaagtcattagtacgtacctttac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry