pGL3-MTS-ND1-W86-L14-G1333C-UGI-Puro
(Plasmid
#198850)
-
PurposeEmploy DdCBE-mediated mtDNA editing to ablate mtProtein(ND1) by swapping Trp codon TGA with stop codon TAA in C6 cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameND1-W86-L14 TALEN
-
SpeciesR. norvegicus (rat)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-MTS-ND1-W86-L14-G1333C-UGI-Puro was a gift from Bin Shen (Addgene plasmid # 198850 ; http://n2t.net/addgene:198850 ; RRID:Addgene_198850) -
For your References section:
A conditional knockout rat resource of mitochondrial protein-coding genes via a DdCBE-induced premature stop codon. Tan L, Qi X, Kong W, Jin J, Lu D, Zhang X, Wang Y, Wang S, Dong W, Shi X, Chen W, Wang J, Li K, Xie Y, Gao L, Guan F, Gao K, Li C, Wang C, Hu Z, Zhang L, Guo X, Shen B, Ma Y. Sci Adv. 2023 Apr 14;9(15):eadf2695. doi: 10.1126/sciadv.adf2695. Epub 2023 Apr 14. 10.1126/sciadv.adf2695 PubMed 37058569