AID∆C-Cas9n-UGI-NLS
(Plasmid
#198890)
-
PurposeExpress AID(1-188) BE3-based base editor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBE3
- Backbone size w/o insert (bp) 9321
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameActication induced deaminase
-
Alt nameAID
-
SpeciesH. sapiens (human)
-
Insert Size (bp)549
-
MutationDeletion of amino acids 189-198
-
Entrez GeneAICDA (a.k.a. AID, ARP2, CDA2, HEL-S-284, HIGM2)
- Promoter CMV
-
Tag
/ Fusion Protein
- NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer CAAAGAAGGAACCAGGTCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also expresses Cas9n-UGI-NLS
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AID∆C-Cas9n-UGI-NLS was a gift from Reuben Harris (Addgene plasmid # 198890 ; http://n2t.net/addgene:198890 ; RRID:Addgene_198890) -
For your References section:
APOBEC Reporter Systems for Evaluating diNucleotide Editing Levels. Rieffer AE, Chen Y, Salamango DJ, Moraes SN, Harris RS. CRISPR J. 2023 Oct;6(5):430-446. doi: 10.1089/crispr.2023.0027. Epub 2023 Sep 6. 10.1089/crispr.2023.0027 PubMed 37672599