RB803
(Plasmid
#199131)
-
PurposeThis plasmid contains a barcoding cassette which gets integrated at Neut5 locus in Candida albicans genome
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199131 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS314
-
Backbone manufacturerATCC
- Backbone size w/o insert (bp) 6599
-
Vector typeYeast Expression
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name100 bp barcoding cassette
-
SpeciesSynthetic
-
Insert Size (bp)100
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site ClaI (unknown if destroyed)
- 5′ sequencing primer GTGCCGTAAAGCACTAAATCGG
- 3′ sequencing primer GTTACCTCACTCATTAGGCACCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
After restriction digestion with NgoMIV, this plasmid can be used to transform Candida strains which would barcode it with unique DNA barcodes
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RB803 was a gift from Richard Bennett (Addgene plasmid # 199131 ; http://n2t.net/addgene:199131 ; RRID:Addgene_199131)