LPUtopia-7
(Plasmid
#199212)
-
PurposeLanding Pad Utopia_v7 donor plasmid for AAVS1 site-specific integration in human cells. Use NeoR and eGFP as positive selection marker for AAVS1-targeted insertion and RFP as negative selection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneDC-RFP-SH01
-
Backbone manufacturerGeneCopoeia
- Backbone size w/o insert (bp) 5630
- Total vector size (bp) 9429
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameaminoglycoside phosphotransferase,
-
Alt nameNeoR/KanR
-
SpeciesSynthetic
-
Insert Size (bp)804
- Promoter thymidine kinase promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer TCCACCCCACAGTGGGGC
- 3′ sequencing primer gagcagattgtactgagagtcgacgg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameenhanced Green Fluorescence Protein
-
Alt nameGFP
-
SpeciesSynthetic
-
Insert Size (bp)719
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer GACATTGATTATTGACTAGTTATTAA
- 3′ sequencing primer ctctcgttaattaactcgag (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameRed Fluorescence Protein
-
Alt nameRFP
-
SpeciesSynthetic
-
Insert Size (bp)699
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gggggactttcctacttggc
- 3′ sequencing primer cagcaacgcggcctttttac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LPUtopia-7 was a gift from Gabor Balazsi (Addgene plasmid # 199212 ; http://n2t.net/addgene:199212 ; RRID:Addgene_199212) -
For your References section:
Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268