Skip to main content

pCMV-BACH1t_RFP
(Plasmid #199214)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199214 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LPUtopia-7
  • Backbone manufacturer
    Balazsi Lab
  • Backbone size w/o insert (bp) 4139
  • Total vector size (bp) 9832
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    BACH1t
  • Alt name
    BTB domain and CNC homolog 1, transcript variant t
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1872
  • GenBank ID
    NR_027655.3
  • Entrez Gene
    BACH1 (a.k.a. BACH-1, BTBD24)
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gacattgattattgactagt
  • 3′ sequencing primer AAACAGTAAgcgactctaga
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    RFP
  • Alt name
    RFP
  • Species
    Synthetic
  • Promoter PGK

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAGAAGCCCGTGgggtag
  • 3′ sequencing primer cagggtaattcgaatttaaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-BACH1t_RFP was a gift from Gabor Balazsi (Addgene plasmid # 199214 ; http://n2t.net/addgene:199214 ; RRID:Addgene_199214)
  • For your References section:

    Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268