pUt-mNF-BACH1
              
              
                (Plasmid
                
                #199219)
              
            
            
            
          - 
            PurposeLPUtopia-7 matching RMCE donor plasmid with GFP-BACH1 Negative-Feedback circuit (mNF-BACH1). Use BlastR for positive selection and HSV-TK for negative selection.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199219 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepDN-D2irTN2AG5kwh
 - 
              Backbone manufacturerBalazsi Lab
 - Backbone size w/o insert (bp) 5090
 - Total vector size (bp) 7546
 - 
              Vector typeMammalian Expression
 - 
                Selectable markersBlasticidin
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Blasticidin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namehTetR::P2A::EGFP::BACH1
 - 
                  Alt nameTetracycline Repressor codon-optimized for human
 - 
                  Alt nameBTB Domain And CNC Homolog 1
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)3657
 - 
                    GenBank IDNM_206866
 - 
                        Entrez GeneBACH1 (a.k.a. BACH-1, BTBD24)
 - Promoter CMV D2ir promoter
 - 
    
        Tag
        / Fusion Protein
    
- EGFP (N terminal on insert)
 
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer GACATTGATTATTGACTAGTTATTAA
 - 3′ sequencing primer CCATAGAGCCCACCGCATCC (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pUt-mNF-BACH1 was a gift from Gabor Balazsi (Addgene plasmid # 199219 ; http://n2t.net/addgene:199219 ; RRID:Addgene_199219) - 
                
For your References section:
Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268