Skip to main content

pUBQ:Citrine-TurboID-3xMyc
(Plasmid #199244)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199244 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCambia3300
  • Backbone size w/o insert (bp) 8396
  • Total vector size (bp) 11776
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Citrine-TurboID-3xMyc
  • Species
    Synthetic
  • Insert Size (bp)
    1798
  • Promoter Arabidopsis UBQ10 promoter with intron
  • Tag / Fusion Protein
    • TurboID-3xMyc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site StuI (unknown if destroyed)
  • 3′ cloning site AvrII (unknown if destroyed)
  • 5′ sequencing primer ctgttaatcttagatcgaagacg
  • 3′ sequencing primer catcgcaagaccggcaacaggattc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    TurboID is from Alice Ting

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUBQ:Citrine-TurboID-3xMyc was a gift from Savithramma Dinesh-Kumar (Addgene plasmid # 199244 ; http://n2t.net/addgene:199244 ; RRID:Addgene_199244)
  • For your References section:

    TurboID-based proximity labeling reveals that UBR7 is a regulator of N NLR immune receptor-mediated immunity. Zhang Y, Song G, Lal NK, Nagalakshmi U, Li Y, Zheng W, Huang PJ, Branon TC, Ting AY, Walley JW, Dinesh-Kumar SP. Nat Commun. 2019 Jul 19;10(1):3252. doi: 10.1038/s41467-019-11202-z. 10.1038/s41467-019-11202-z PubMed 31324801