SPDK3959
(Plasmid
#199246)
-
PurposeModified TRV RNA2 with PEBV promoter and AtIleu-tRNA vector with AtPDS3 target for editing Arabidopsis PDS3 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAMBIS0390 T-DNA vector
- Backbone size w/o insert (bp) 6812
- Total vector size (bp) 11056
-
Vector typeT-DNA vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWe prefer to grow in DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameModified TRV RNA2 with PEBV promoter, AtPDS3 target and AtIleu-tRNA mobile RNA sequence
-
Insert Size (bp)2956
- Promoter PEBV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer CATAATTATACTGATTTGTCTCTCG
- 3′ sequencing primer caaaagacttaccgatcaatcaag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SPDK3959 was a gift from Savithramma Dinesh-Kumar (Addgene plasmid # 199246 ; http://n2t.net/addgene:199246 ; RRID:Addgene_199246) -
For your References section:
High-efficiency multiplex biallelic heritable editing in Arabidopsis using an RNA virus. Nagalakshmi U, Meier N, Liu JY, Voytas DF, Dinesh-Kumar SP. Plant Physiol. 2022 Jun 27;189(3):1241-1245. doi: 10.1093/plphys/kiac159. 10.1093/plphys/kiac159 PubMed 35389493