hPLD3-sgRNA-Cas9_mcherry
(Plasmid
#199342)
-
Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherry
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPRv2
-
Backbone manufactureradapted from addgene #75161
- Backbone size w/o insert (bp) 6800
- Total vector size (bp) 6800
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehSpCas9
-
gRNA/shRNA sequencetagcgggtgtcatagaaccg
- Promoter human U6
-
Tag
/ Fusion Protein
- P2A-RFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAC TAT CAT ATG CTT ACC GT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone was adapted from addgene #99154, where lentiviral elements were deleted.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hPLD3-sgRNA-Cas9_mcherry was a gift from David Nemazee (Addgene plasmid # 199342 ; http://n2t.net/addgene:199342 ; RRID:Addgene_199342)