Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

hPLD3-sgRNA-Cas9_mcherry
(Plasmid #199342)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 199342 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiCRISPRv2
  • Backbone manufacturer
    adapted from addgene #75161
  • Backbone size w/o insert (bp) 6800
  • Total vector size (bp) 6800
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hSpCas9
  • gRNA/shRNA sequence
    tagcgggtgtcatagaaccg
  • Promoter human U6
  • Tag / Fusion Protein
    • P2A-RFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAC TAT CAT ATG CTT ACC GT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone was adapted from addgene #99154, where lentiviral elements were deleted.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hPLD3-sgRNA-Cas9_mcherry was a gift from David Nemazee (Addgene plasmid # 199342 ; http://n2t.net/addgene:199342 ; RRID:Addgene_199342)