Skip to main content

pGEX6P-1-eIF4E K119A
(Plasmid #199440)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199440 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX6P-1
  • Backbone size w/o insert (bp) 4980
  • Total vector size (bp) 5727
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    1977
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    747
  • Mutation
    changed lysine 119 to alanine
  • GenBank ID
    NM_001968.5
  • Entrez Gene
    EIF4E (a.k.a. AUTS19, CBP, EIF4E1, EIF4EL1, EIF4F, eIF-4E)
  • Tag / Fusion Protein
    • GST-fusion protein (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer AGCGGATAACAATTTCACACAGG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P-1-eIF4E K119A was a gift from Shin-ichi Hoshino (Addgene plasmid # 199440 ; http://n2t.net/addgene:199440 ; RRID:Addgene_199440)
  • For your References section:

    Protocol for analyzing intact mRNA poly(A) tail length using nanopore direct RNA sequencing. Ogami K, Oishi Y, Hoshino SI. STAR Protoc. 2023 May 26;4(2):102340. doi: 10.1016/j.xpro.2023.102340. 10.1016/j.xpro.2023.102340 PubMed 37243600