Skip to main content

pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
(Plasmid #199454)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199454 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TS2 sgRNA
  • gRNA/shRNA sequence
    GGAGCTTACTGAGACTCTTC
  • Species
    Synthetic
  • Promoter mouse U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCA23-sgRNA vector-U6-sgTS2 (SpCas9) was a gift from Baohui Chen (Addgene plasmid # 199454 ; http://n2t.net/addgene:199454 ; RRID:Addgene_199454)
  • For your References section:

    Gene activation guided by nascent RNA-bound transcription factors. Liang Y, Xu H, Cheng T, Fu Y, Huang H, Qian W, Wang J, Zhou Y, Qian P, Yin Y, Xu P, Zou W, Chen B. Nat Commun. 2022 Nov 28;13(1):7329. doi: 10.1038/s41467-022-35041-7. 10.1038/s41467-022-35041-7 PubMed 36443367