PB513B-1/TRE-hHNF1β-hHNF4α-hHNF6-EF1α-Bla
(Plasmid
#199551)
-
PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1β-hHNF4α-hHNF6) under control of the TRE/PCMVmin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePB513B-1
-
Backbone manufacturerSBI
-
Vector typeMammalian Expression ; PiggyBac transposon vector
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehHNF1β-hHNF4α-hHNF6
-
SpeciesH. sapiens (human)
-
Entrez GeneONECUT1 (a.k.a. HNF-6, HNF6, HNF6A)
-
Entrez GeneHNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
-
Entrez GeneHNF1B (a.k.a. ADTKD3, FJHN, HNF-1-beta, HNF-1B, HNF1beta, HNF2, HPC11, LF-B3, LFB3, MODY5, RCAD, T2D, TCF-2, TCF2, VHNF1)
- Promoter TRE+CMVmin promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
- 3′ sequencing primer AGCGGATAACAATTTCACACAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB513B-1/TRE-hHNF1β-hHNF4α-hHNF6-EF1α-Bla was a gift from Masamichi Kamihira (Addgene plasmid # 199551 ; http://n2t.net/addgene:199551 ; RRID:Addgene_199551) -
For your References section:
HepG2-Based Designer Cells with Heat-Inducible Enhanced Liver Functions. Kitano H, Kawabe Y, Kamihira M. Cells. 2022 Apr 1;11(7):1194. doi: 10.3390/cells11071194. 10.3390/cells11071194 PubMed 35406758