pX552-DIO-NLS-mRuby3(with gRNA scaffold)
(Plasmid
#199583)
-
PurposeExpresses NLS-mRuby3 in a Cre-dependent manner
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199583 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepX552
- Backbone size w/o insert (bp) 5455
- Total vector size (bp) 6166
-
Vector typeMammalian Expression, AAV, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-mRuby3
-
SpeciesSynthetic
-
Insert Size (bp)756
- Promoter U6 and EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GCTTCACCATCGACCCGAATTGCC
- 3′ sequencing primer GGCAACTTCCAGGGCCAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthesized
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PX552 was a gift from Feng Zhang (Addgene plasmid # 60958 ; http://n2t.net/addgene:60958 ; RRID:Addgene_60958)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX552-DIO-NLS-mRuby3(with gRNA scaffold) was a gift from Bryan Copits (Addgene plasmid # 199583 ; http://n2t.net/addgene:199583 ; RRID:Addgene_199583) -
For your References section:
Cell-Specific Single Viral Vector CRISPR/Cas9 Editing and Genetically Encoded Tool Delivery in the Central and Peripheral Nervous Systems. Moffa JC, Bland IN, Tooley JR, Kalyanaraman V, Heitmeier M, Creed MC, Copits BA. eNeuro. 2024 Jul 5;11(7):ENEURO.0438-23.2024. doi: 10.1523/ENEURO.0438-23.2024. Print 2024 Jul. 10.1523/ENEURO.0438-23.2024 PubMed 38871457