Skip to main content

pX552-DIO-NLS-mRuby3(with gRNA scaffold)
(Plasmid #199583)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199583 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pX552
  • Backbone size w/o insert (bp) 5455
  • Total vector size (bp) 6166
  • Vector type
    Mammalian Expression, AAV, Cre/Lox, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-mRuby3
  • Species
    Synthetic
  • Insert Size (bp)
    756
  • Promoter U6 and EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GCTTCACCATCGACCCGAATTGCC
  • 3′ sequencing primer GGCAACTTCCAGGGCCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthesized

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PX552 was a gift from Feng Zhang (Addgene plasmid # 60958 ; http://n2t.net/addgene:60958 ; RRID:Addgene_60958)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX552-DIO-NLS-mRuby3(with gRNA scaffold) was a gift from Bryan Copits (Addgene plasmid # 199583 ; http://n2t.net/addgene:199583 ; RRID:Addgene_199583)
  • For your References section:

    Cell-Specific Single Viral Vector CRISPR/Cas9 Editing and Genetically Encoded Tool Delivery in the Central and Peripheral Nervous Systems. Moffa JC, Bland IN, Tooley JR, Kalyanaraman V, Heitmeier M, Creed MC, Copits BA. eNeuro. 2024 Jul 5;11(7):ENEURO.0438-23.2024. doi: 10.1523/ENEURO.0438-23.2024. Print 2024 Jul. 10.1523/ENEURO.0438-23.2024 PubMed 38871457