pLV-SARS-COV-2-5UTR-GLuc
(Plasmid
#199592)
-
PurposeExpress SARS-CoV-2 5 UTR in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLV
- Backbone size w/o insert (bp) 9056
- Total vector size (bp) 9906
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 5UTR-GLuc
-
Alt nameSARS-CoV-2
-
Insert Size (bp)849
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aatgtagtcttatgcaatactctt
- 3′ sequencing primer aagcttgcagctccagcttttgtt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-SARS-COV-2-5UTR-GLuc was a gift from Jingxin Wang (Addgene plasmid # 199592 ; http://n2t.net/addgene:199592 ; RRID:Addgene_199592) -
For your References section:
Chemical-guided SHAPE sequencing (cgSHAPE-seq) informs the binding site of RNA-degrading chimeras targeting SARS-CoV-2 5' untranslated region. Tang Z, Hegde S, Hao S, Selvaraju M, Qiu J, Wang J. Nat Commun. 2025 Jan 8;16(1):483. doi: 10.1038/s41467-024-55608-w. 10.1038/s41467-024-55608-w PubMed 39779694