pEGFPC2-gephyrin S268E/270E
(Plasmid
#199609)
-
PurposeEncodes N-terminal eGFP-tagged P1-gephyrin S268/270E for expression in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199609 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFPC2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGephyrin
-
SpeciesR. norvegicus (rat)
-
MutationS268E/S270E
-
Entrez GeneGphn (a.k.a. Geph)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ACCCTAACTGACACACATTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFPC2-gephyrin S268E/270E was a gift from Shiva Tyagarajan (Addgene plasmid # 199609 ; http://n2t.net/addgene:199609 ; RRID:Addgene_199609) -
For your References section:
Extracellular signal-regulated kinase and glycogen synthase kinase 3beta regulate gephyrin postsynaptic aggregation and GABAergic synaptic function in a calpain-dependent mechanism. Tyagarajan SK, Ghosh H, Yevenes GE, Imanishi SY, Zeilhofer HU, Gerrits B, Fritschy JM. J Biol Chem. 2013 Apr 5;288(14):9634-47. doi: 10.1074/jbc.M112.442616. Epub 2013 Feb 13. 10.1074/jbc.M112.442616 PubMed 23408424