Skip to main content

pcDNA3.1_27B3_hFc
(Plasmid #199618)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199618 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6800
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    DARPin-hFc 27B3
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • hFc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HTC DARPin name 008-855-2308-C11

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1_27B3_hFc was a gift from Shiva Tyagarajan (Addgene plasmid # 199618 ; http://n2t.net/addgene:199618 ; RRID:Addgene_199618)
  • For your References section:

    A DARPin-based molecular toolset to probe gephyrin and inhibitory synapse biology. Campbell BFN, Dittmann A, Dreier B, Pluckthun A, Tyagarajan SK. Elife. 2022 Oct 31;11:e80895. doi: 10.7554/eLife.80895. 10.7554/eLife.80895 PubMed 36314779