pCAG1.1-HA/Ppp1cc2
(Plasmid
#199626)
-
PurposeExpression vector of mouse PPP1CC2. HA tag at N-terminus.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199626 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG1.1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePpp1cc mRNA (variant X1)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1011
-
Entrez GenePpp1cc (a.k.a. PP-1G, PP1, dis2m1)
- Promoter CAG
-
Tag
/ Fusion Protein
- HA-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GTTCGGCTTCTGGCGTGTGA
- 3′ sequencing primer ATAAATTTCCTTTATTAGCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG1.1-HA/Ppp1cc2 was a gift from Masahito Ikawa (Addgene plasmid # 199626 ; http://n2t.net/addgene:199626 ; RRID:Addgene_199626) -
For your References section:
TSKS localizes to nuage in spermatids and regulates cytoplasmic elimination during spermiation. Shimada K, Park S, Oura S, Noda T, Morohoshi A, Matzuk MM, Ikawa M. Proc Natl Acad Sci U S A. 2023 Mar 14;120(11):e2221762120. doi: 10.1073/pnas.2221762120. Epub 2023 Mar 7. 10.1073/pnas.2221762120 PubMed 36881620