Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG1.1-HA/Ppp1cc2
(Plasmid #199626)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 199626 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG1.1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ppp1cc mRNA (variant X1)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1011
  • Entrez Gene
    Ppp1cc (a.k.a. PP-1G, PP1, dis2m1)
  • Promoter CAG
  • Tag / Fusion Protein
    • HA-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GTTCGGCTTCTGGCGTGTGA
  • 3′ sequencing primer ATAAATTTCCTTTATTAGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG1.1-HA/Ppp1cc2 was a gift from Masahito Ikawa (Addgene plasmid # 199626 ; http://n2t.net/addgene:199626 ; RRID:Addgene_199626)
  • For your References section:

    TSKS localizes to nuage in spermatids and regulates cytoplasmic elimination during spermiation. Shimada K, Park S, Oura S, Noda T, Morohoshi A, Matzuk MM, Ikawa M. Proc Natl Acad Sci U S A. 2023 Mar 14;120(11):e2221762120. doi: 10.1073/pnas.2221762120. Epub 2023 Mar 7. 10.1073/pnas.2221762120 PubMed 36881620