pcDNA3.1 GIL-11 myc TEV TwinStrep
(Plasmid
#199627)
-
PurposeEucaryotic expression plasmid for chimeric cytokine of IL-11 and LIF (GIL-11) with a TwinStrep-tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerBioCat GmbH
- Backbone size w/o insert (bp) 5625
- Total vector size (bp) 6441
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418) ; Kanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGIL-11
-
Alt nameChimeric synthetic cytokine between IL-11 and LIF
-
SpeciesH. sapiens (human)
-
Insert Size (bp)816
-
GenBank IDNC_000022.11 NC_000019.10
- Promoter T7
-
Tag
/ Fusion Protein
- TwinStrep-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer AGGCACAGTCGAGGCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe molecule was structure-based in-silico designed. The DNA was then synthesized and ordered from BioCat GmbH
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1 GIL-11 myc TEV TwinStrep was a gift from Jurgen Scheller (Addgene plasmid # 199627 ; http://n2t.net/addgene:199627 ; RRID:Addgene_199627) -
For your References section:
Cytokimera GIL-11 rescued IL-6R deficient mice from partial hepatectomy-induced death by signaling via non-natural gp130:LIFR:IL-11R complexes. Rafii P, Seibel C, Weitz HT, Ettich J, Minafra AR, Petzsch P, Lang A, Floss DM, Behnke K, Kohrer K, Moll JM, Scheller J. Commun Biol. 2023 Apr 15;6(1):418. doi: 10.1038/s42003-023-04768-4. 10.1038/s42003-023-04768-4 PubMed 37061565