pR6K-GFP-CASTV
(Plasmid
#199657)
-
PurposeR6K plasmid encoding a type V CAST but no CRISPR array
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199657 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneR6k
- Backbone size w/o insert (bp) 10012
- Total vector size (bp) 11012
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCAST V systems
-
Insert Size (bp)10000
- Promoter J23119 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttgatcggcacgtaagaggttcca
- 3′ sequencing primer gaaggccatcctgacggatggcctttt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.03.03.531003v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pR6K-GFP-CASTV was a gift from IIya Finkelstein (Addgene plasmid # 199657 ; http://n2t.net/addgene:199657 ; RRID:Addgene_199657)