Skip to main content

OMM-V5-LOV-Turbo
(Plasmid #199665)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199665 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW
  • Backbone size w/o insert (bp) 7716
  • Total vector size (bp) 9324
  • Modifications to backbone
    TRE3G promoter
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LOV-Turbo
  • Alt name
    Light regulated TurboID
  • Species
    Synthetic
  • Insert Size (bp)
    1362
  • Promoter TRE3G
  • Tags / Fusion Proteins
    • AKAP1 transmembrane domain (N terminal on insert)
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcagagctcgtttagtgaaccg
  • 3′ sequencing primer aaagcagcgtatccacatagcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    OMM-V5-LOV-Turbo was a gift from Alice Ting (Addgene plasmid # 199665 ; http://n2t.net/addgene:199665 ; RRID:Addgene_199665)
  • For your References section:

    Engineered allostery in light-regulated LOV-Turbo enables precise spatiotemporal control of proximity labeling in living cells. Lee SY, Cheah JS, Zhao B, Xu C, Roh H, Kim CK, Cho KF, Udeshi ND, Carr SA, Ting AY. Nat Methods. 2023 May 15. doi: 10.1038/s41592-023-01880-5. 10.1038/s41592-023-01880-5 PubMed 37188954