AAV_CAG_V5-LOV-Turbo-NES
(Plasmid
#199670)
-
Purposeexpresses V5-LOV-Turbo-NES in mammalian cells, AAV vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199670 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5031
- Total vector size (bp) 6489
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLOV-Turbo
-
Alt nameLight regulated TurboID
-
SpeciesSynthetic
-
Insert Size (bp)1362
- Promoter CAG
-
Tags
/ Fusion Proteins
- V5 (N terminal on insert)
- NES (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggttcggcttctggcgtgtgacc
- 3′ sequencing primer aaagcagcgtatccacatagcg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.03.09.531939v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV_CAG_V5-LOV-Turbo-NES was a gift from Alice Ting (Addgene plasmid # 199670 ; http://n2t.net/addgene:199670 ; RRID:Addgene_199670) -
For your References section:
Engineered allostery in light-regulated LOV-Turbo enables precise spatiotemporal control of proximity labeling in living cells. Lee SY, Cheah JS, Zhao B, Xu C, Roh H, Kim CK, Cho KF, Udeshi ND, Carr SA, Ting AY. Nat Methods. 2023 May 15. doi: 10.1038/s41592-023-01880-5. 10.1038/s41592-023-01880-5 PubMed 37188954