pCAG-1700029I15Rik-3×FLAG
(Plasmid
#199689)
-
PurposeExpression vector of mouse 1700029I15Rik. 3XFLAG tag at C-terminus.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG1.1
-
Backbone manufacturerIkawa Lab
- Backbone size w/o insert (bp) 5259
- Total vector size (bp) 5556
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name1700029I15Rik
-
Alt nameFrey
-
Alt nameFrey1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)297
-
Entrez Gene1700029I15Rik
- Promoter CAG
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer GCCACACCAGCCACCACCTTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-1700029I15Rik-3×FLAG was a gift from Masahito Ikawa (Addgene plasmid # 199689 ; http://n2t.net/addgene:199689 ; RRID:Addgene_199689) -
For your References section:
1700029I15Rik orchestrates the biosynthesis of acrosomal membrane proteins required for sperm-egg interaction. Lu Y, Shimada K, Tang S, Zhang J, Ogawa Y, Noda T, Shibuya H, Ikawa M. Proc Natl Acad Sci U S A. 2023 Feb 21;120(8):e2207263120. doi: 10.1073/pnas.2207263120. Epub 2023 Feb 14. 10.1073/pnas.2207263120 PubMed 36787362