tracrRNA(scr)-CJ8421_04975 mRNA
(Plasmid #199718)

• Purpose: Expresses the Campylobacter mRNA CJ8421_04975 and tracrRNA with scrambled anti-repeat sequencesequence
• Depositing Lab: Chase Beisel
• Publication: Jiao et al Nat Biotechnol. 2023 Jan 5. doi: 10.1038/s41587-022-01604-8.

Backbone

• Vector backbone: pCSM180
• Backbone size w/o insert (bp): 2116
• Total vector size (bp): 3488
• Modifications to backbone: Inserts CJ8421_04975 mRNA and scrambled tracrRNA
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): One Shot™ TOP10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CJ8421_04975 mRNA and scrambled tracrRNA
• Species: Campylobacter jejuni
• Insert Size (bp): 1372

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tcgggtttcgccacctctgact
• 3′ sequencing primer: tcgctgagataggtgcctcac

Resource Information

• Supplemental Documents:
  • tracrrnascr-cj8421_04975-mrna.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry