pAAV.cc81-mut
(Plasmid
#199745)
-
PurposeExpresses AAV2 Rep and AAV.cc81 Cap
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMCV
- Backbone size w/o insert (bp) 1799
- Total vector size (bp) 6088
-
Modifications to backboneInserted AAV2 Rep and AAV.cc84 Cap
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAV.cc81 Cap
-
SpeciesSynthetic
-
Insert Size (bp)2211
-
Mutationmutated amino acids 586-592 in Cap
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer CATGTGGTCACGCTGGGTATTTAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV.cc81-mut was a gift from Aravind Asokan (Addgene plasmid # 199745 ; http://n2t.net/addgene:199745 ; RRID:Addgene_199745) -
For your References section:
Structure-guided AAV capsid evolution strategies for enhanced CNS gene delivery. Gonzalez TJ, Mitchell-Dick A, Blondel LO, Fanous MM, Hull JA, Oh DK, Moller-Tank S, Castellanos Rivera RM, Piedrahita JA, Asokan A. Nat Protoc. 2023 Sep 21. doi: 10.1038/s41596-023-00875-y. 10.1038/s41596-023-00875-y PubMed 37735235