Skip to main content

TccCas13a Twin SUMO
(Plasmid #199754)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199754 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Twin-SUMO
  • Backbone size w/o insert (bp) 6076
  • Total vector size (bp) 9761
  • Vector type
    Bacterial Expression
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TccCas13a
  • Species
    Thermoclostridium caenicola
  • Insert Size (bp)
    3678
  • Promoter LacI
  • Tag / Fusion Protein
    • SUMO (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer gaaattaatacgactcactatagggg
  • 3′ sequencing primer caaaaaacccctcaagacccg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TccCas13a Twin SUMO was a gift from Magdy Mahfouz (Addgene plasmid # 199754 ; http://n2t.net/addgene:199754 ; RRID:Addgene_199754)
  • For your References section:

    Characterization of a thermostable Cas13 enzyme for one-pot detection of SARS-CoV-2. Mahas A, Marsic T, Lopez-Portillo Masson M, Wang Q, Aman R, Zheng C, Ali Z, Alsanea M, Al-Qahtani A, Ghanem B, Alhamlan F, Mahfouz M. Proc Natl Acad Sci U S A. 2022 Jul 12;119(28):e2118260119. doi: 10.1073/pnas.2118260119. Epub 2022 Jun 28. 10.1073/pnas.2118260119 PubMed 35763567