Vector 1174D
(Plasmid
#200012)
-
PurposeFluorescent based sex separator in Aedes aegypti (SEPARATOR)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePiggyBac
-
Vector typeInsect Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEngineered dobulesex splicing module
-
SpeciesSynthetic; Aedes aegypti
-
Insert Size (bp)4515
-
MutationEngineered dobulesex splicing module
-
GenBank IDNC_035107.1 AAEL009114
- Promoter Hr5IE1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atcgtgaacaaccaagtgacttaattaaCAAAATGAACGACGAACTTGTCAAACGATCTC
- 3′ sequencing primer GTTATCCTCCTCGCCCTTGCTCACCATTCCGGCGAGCTGGACTGTGACCGGGTAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Vector 1174D was a gift from Omar Akbari (Addgene plasmid # 200012 ; http://n2t.net/addgene:200012 ; RRID:Addgene_200012) -
For your References section:
Efficient Sex Separation by Exploiting Differential Alternative Splicing of a Dominant Marker in Aedes aegypti. Weng SC, Antoshechkin I, Marois E, Akbari OS. bioRxiv. 2023 Jun 16:2023.06.16.545348. doi: 10.1101/2023.06.16.545348. Preprint. 10.1101/2023.06.16.545348 PubMed 37398094