pLJM1-zeo E321K ORF29
(Plasmid
#200025)
-
PurposeLentiviral vector for expression of KSHV ORF29 with E321K mutation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLJM1
- Backbone size w/o insert (bp) 7054
- Total vector size (bp) 9099
-
Vector typeLentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORF29
-
Alt nameTRM3
-
SpeciesKaposi's Sarcoma Associated Herpesvirus (HHV-8)
-
Insert Size (bp)2064
-
MutationGlutamic acid 321 changed to lysine
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ggatctctgctgtccctgtaataaacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.01.29.526158 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-zeo E321K ORF29 was a gift from Britt Glaunsinger (Addgene plasmid # 200025 ; http://n2t.net/addgene:200025 ; RRID:Addgene_200025) -
For your References section:
The viral packaging motor potentiates Kaposi's sarcoma-associated herpesvirus gene expression late in infection. McCollum CO, Didychuk AL, Liu D, Murray-Nerger LA, Cristea IM, Glaunsinger BA. PLoS Pathog. 2023 Apr 17;19(4):e1011163. doi: 10.1371/journal.ppat.1011163. eCollection 2023 Apr. 10.1371/journal.ppat.1011163 PubMed 37068108