Skip to main content
Addgene

pTHY_P0029_T2c_BCD_23K
(Plasmid #200047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200047 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC
  • Total vector size (bp) 3278
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BCD 23K
  • Species
    Synthetic
  • Insert Size (bp)
    167

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer acagggctataaggtagatccggg
  • 3′ sequencing primer ctcttttctggaatttggtaccgagggtgacttc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid encodes a part for use in a heirarchical golden gate plasmid assembly system. The part insert is a bicistronic translational control element for regulating translation of protein-coding genes in E. coli. It is flanked by sites for the type IIS restriction enzyme BsaI and yields 5' and 3' overhangs of GGAG and TATG respectively. The backbone contains a pUC origin, a TEM-1 ampicillin resistance marker, and a ccdB marker such that the part plasmid does not carry through into higher order plasmid assemblies. The plasmid must be propagated in an E. coli strain which is resistant to ccdB.

Please visit https://www.biorxiv.org/content/10.1101/2023.02.09.527918v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTHY_P0029_T2c_BCD_23K was a gift from Ross Thyer (Addgene plasmid # 200047 ; http://n2t.net/addgene:200047 ; RRID:Addgene_200047)
  • For your References section:

    Interrogating the Function of Bicistronic Translational Control Elements to Improve Consistency of Gene Expression. Jansen Z, Reilly SR, Lieber-Kotz M, Li AZ, Wei Q, Kulhanek DL, Gilmour AR, Thyer R. ACS Synth Biol. 2023 Jun 16;12(6):1608-1615. doi: 10.1021/acssynbio.3c00093. Epub 2023 May 30. 10.1021/acssynbio.3c00093 PubMed 37253269