U6-sgRNAs-Crym
(Plasmid
#200067)
-
PurposeFor the knock down of Crym with an astrocyte specific mCherry expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200067 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePZac2.1
-
Backbone manufacturerKhakh lab
- Backbone size w/o insert (bp) 3472
- Total vector size (bp) 6319
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameU6-3xsgRNA-Crym
-
Alt namesgRNA-Crym
-
gRNA/shRNA sequencemouse u-crystallin (gene Crym)
-
SpeciesM. musculus (mouse)
-
GenBank ID12971
- Promoter U6, GfaABC1D
-
Tag
/ Fusion Protein
- GfaABC1D-mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs1 (destroyed during cloning)
- 3′ cloning site Bbs1 (destroyed during cloning)
- 5′ sequencing primer gctctaggaagatcaagatcagatct
- 3′ sequencing primer ctgagctggctctgtgagct (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6-sgRNAs-Crym was a gift from Baljit Khakh (Addgene plasmid # 200067 ; http://n2t.net/addgene:200067 ; RRID:Addgene_200067) -
For your References section:
Crym-positive striatal astrocytes gate perseverative behaviour. Ollivier M, Soto JS, Linker KE, Moye SL, Jami-Alahmadi Y, Jones AE, Divakaruni AS, Kawaguchi R, Wohlschlegel JA, Khakh BS. Nature. 2024 Mar;627(8003):358-366. doi: 10.1038/s41586-024-07138-0. Epub 2024 Feb 28. 10.1038/s41586-024-07138-0 PubMed 38418885