GfaABC1D-Crym-eGFP
(Plasmid
#200080)
-
PurposeTo study u-crystallin protein interactors, control plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200080 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonePZac2.1
- Backbone size w/o insert (bp) 3307
- Total vector size (bp) 6784
-
Vector typeMouse Targeting, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGfaABC1D-Crym-eGFP
-
SpeciesM. musculus (mouse)
- Promoter GfaABC1D
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer ctcaagcttcgaattatgaagcgggcgccagcg
- 3′ sequencing primer gattcttggtcatctggcaaggatccaccggtcgcc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GfaABC1D-Crym-eGFP was a gift from Baljit Khakh (Addgene plasmid # 200080 ; http://n2t.net/addgene:200080 ; RRID:Addgene_200080) -
For your References section:
Crym-positive striatal astrocytes gate perseverative behaviour. Ollivier M, Soto JS, Linker KE, Moye SL, Jami-Alahmadi Y, Jones AE, Divakaruni AS, Kawaguchi R, Wohlschlegel JA, Khakh BS. Nature. 2024 Mar;627(8003):358-366. doi: 10.1038/s41586-024-07138-0. Epub 2024 Feb 28. 10.1038/s41586-024-07138-0 PubMed 38418885