Skip to main content

pJL1_CSL3
(Plasmid #200173)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200173 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJL1
  • Backbone size w/o insert (bp) 1763
  • Total vector size (bp) 2426
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CSL3
  • Insert Size (bp)
    663
  • Promoter T7
  • Tags / Fusion Proteins
    • 6x His tag (N terminal on insert)
    • TEV cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL1_CSL3 was a gift from Michael Jewett (Addgene plasmid # 200173 ; http://n2t.net/addgene:200173 ; RRID:Addgene_200173)
  • For your References section:

    Cell-free expression and characterization of multivalent rhamnose-binding lectins using biolayer interferometry. Warfel KF, Laigre E, Sobol SE, Gillon E, Varrot A, Renaudet O, Dejeu J, Jewett MC, Imberty A. Glycobiology. 2023 Mar 7:cwad018. doi: 10.1093/glycob/cwad018. 10.1093/glycob/cwad018 PubMed 36882003