Skip to main content

pSEMS-Tom20-mEGFP-reHaloTagF
(Plasmid #200190)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200190 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSEMS(26m)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tom20
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    435
  • Entrez Gene
    TOMM20 (a.k.a. MAS20, MOM19, TOM20)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mEGFP (C terminal on insert)
    • reHaloTagF (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer ATGGTGGGTCGGAACAGCGCCAT
  • 3′ sequencing primer TTCCACATCATCTTCAGCCAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSEMS-Tom20-mEGFP-reHaloTagF was a gift from Jacob Piehler (Addgene plasmid # 200190 ; http://n2t.net/addgene:200190 ; RRID:Addgene_200190)
  • For your References section:

    Reversible Live-Cell Labeling with Retro-engineered HaloTags Enables Long-Term High- and Super-Resolution Imaging. Holtmannspotter M, Wienbeuker E, Dellmann T, Watrinet I, Garcia-Saez AJ, Johnsson K, Kurre R, Piehler J. Angew Chem Int Ed Engl. 2023 Feb 3:e202219050. doi: 10.1002/anie.202219050. 10.1002/anie.202219050 PubMed 36735334