pSEMS-Tom20-mEGFP-reHaloTagF
(Plasmid
#200190)
-
PurposeTom20 with reversible HaloTagF variant for fluorescent labeling
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSEMS(26m)
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTom20
-
SpeciesH. sapiens (human)
-
Insert Size (bp)435
-
Entrez GeneTOMM20 (a.k.a. MAS20, MOM19, TOM20)
- Promoter CMV
-
Tags
/ Fusion Proteins
- mEGFP (C terminal on insert)
- reHaloTagF (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer ATGGTGGGTCGGAACAGCGCCAT
- 3′ sequencing primer TTCCACATCATCTTCAGCCAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSEMS-Tom20-mEGFP-reHaloTagF was a gift from Jacob Piehler (Addgene plasmid # 200190 ; http://n2t.net/addgene:200190 ; RRID:Addgene_200190) -
For your References section:
Reversible Live-Cell Labeling with Retro-engineered HaloTags Enables Long-Term High- and Super-Resolution Imaging. Holtmannspotter M, Wienbeuker E, Dellmann T, Watrinet I, Garcia-Saez AJ, Johnsson K, Kurre R, Piehler J. Angew Chem Int Ed Engl. 2023 Feb 3:e202219050. doi: 10.1002/anie.202219050. 10.1002/anie.202219050 PubMed 36735334