HSF1 KO
(Plasmid
#200207)
-
PurposegRNA for HSF1 KO
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200207 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHSF1 KO
-
gRNA/shRNA sequenceTCTCGGACGAAAGCAGGCAG, ATGTCCTAGGGATAGGTTGG
-
SpeciesM. musculus (mouse)
-
MutationNone
-
Entrez GeneHsf1 (a.k.a. HSTF, HSTF 1, Hsf1alpha, Hsf1beta)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.05.511012v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HSF1 KO was a gift from Sheila Teves (Addgene plasmid # 200207 ; http://n2t.net/addgene:200207 ; RRID:Addgene_200207) -
For your References section:
Heat shock transcription factors demonstrate a distinct mode of interaction with mitotic chromosomes. Price RM, Budzynski MA, Shen J, Mitchell JE, Kwan JZJ, Teves SS. Nucleic Acids Res. 2023 Apr 28:gkad304. doi: 10.1093/nar/gkad304. 10.1093/nar/gkad304 PubMed 37114996