pXY349
(Plasmid
#200262)
-
PurposeExpressing FtsW-TagRFP-T in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIQ
- Backbone size w/o insert (bp) 4674
- Total vector size (bp) 6693
-
Modifications to backbonemodify the −35 region of the lacIQ promoter from GTGCAA to TTGACA.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFtsW-tagRFP
-
Insert Size (bp)2019
-
Entrez GeneftsW (a.k.a. b0089, ECK0090)
- Promoter LacI
-
Tag
/ Fusion Protein
- tagRFP (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctttcgtcttcacctcgagaaatc
- 3′ sequencing primer gctaattaagcttggctgcaggt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXY349 was a gift from Jie Xiao (Addgene plasmid # 200262 ; http://n2t.net/addgene:200262 ; RRID:Addgene_200262) -
For your References section:
A two-track model for the spatiotemporal coordination of bacterial septal cell wall synthesis revealed by single-molecule imaging of FtsW. Yang X, McQuillen R, Lyu Z, Phillips-Mason P, De La Cruz A, McCausland JW, Liang H, DeMeester KE, Santiago CC, Grimes CL, de Boer P, Xiao J. Nat Microbiol. 2021 May;6(5):584-593. doi: 10.1038/s41564-020-00853-0. Epub 2021 Jan 25. 10.1038/s41564-020-00853-0 PubMed 33495624