pRRL-VinculinI997A_TurboID_Venus
(Plasmid
#200273)
-
PurposeLentivirus vector expressing actin-binding-deficient vinculin mutant with co-localization labeler TurboID and fluorescence reporter Venus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 6840
- Total vector size (bp) 11740
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVinculinI997A_TurboID_Venus
-
Alt nameVinI997A-TurboID-Ven
-
SpeciesG. gallus (chicken), Synthetic
-
Insert Size (bp)4899
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTAAACGGCCACAAGTTCAGC
- 3′ sequencing primer GACGTAGCCTTCGGGCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL-VinculinI997A_TurboID_Venus was a gift from Brenton Hoffman (Addgene plasmid # 200273 ; http://n2t.net/addgene:200273 ; RRID:Addgene_200273) -
For your References section:
Identifying constitutive and context-specific molecular-tension-sensitive protein recruitment within focal adhesions. Tao A, LaCroix AS, Shoyer TC, Venkatraman V, Xu KL, Feiger B, Hoffman BD. Dev Cell. 2023 Mar 10:S1534-5807(23)00074-6. doi: 10.1016/j.devcel.2023.02.015. 10.1016/j.devcel.2023.02.015 PubMed 36924770