PX458_3XHA_dFnCas9_KRAB_T2A_eGFP
(Plasmid
#200389)
-
Purpose3XHA tagged dead Cas9 from F. novicida with KRAB repressor domain, T2A self-cleaving peptide and enhanced GFP biomarker for mammalian expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200389 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePX458
- Backbone size w/o insert (bp) 4243
- Total vector size (bp) 10320
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePX458_3XHA_dFnCas9_KRAB_eGFP
-
Alt nameDead FnCas9 with 3XHA tag, KRAB domain and eGFP for mammalian expression
-
Alt namedFnCas9b
-
SpeciesSynthetic; Francisella novicida U112
-
Insert Size (bp)6077
-
GenBank IDNZ_CP009607.1
- Promoter CBH
-
Tags
/ Fusion Proteins
- 3xHA-NLS (N terminal on insert)
- SV40NLS-KRAB-T2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Eco53kI (not destroyed)
- 5′ sequencing primer CTGGCTTATAGGTCTAGGCGCGTGAAGATCAAAAG
- 3′ sequencing primer CTTTTGATCTTCACGCGCCTAGACCTATAAGCCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Subcloned from PX408, a gift from Feng Zhang's Lab
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458_3XHA_dFnCas9_KRAB_T2A_eGFP was a gift from Debojyoti Chakraborty (Addgene plasmid # 200389 ; http://n2t.net/addgene:200389 ; RRID:Addgene_200389)