pKLV2-U6gRNA5(MRPS26(12))-PGKpuro2ABFP-W
(Plasmid
#200498)
-
PurposeLentiviral vector expressing gRNA targeting human MRPS26
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 8648
- Total vector size (bp) 8650
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMRPS26(12)
-
gRNA/shRNA sequenceGCACACCTGAGGGCGCGCA
-
SpeciesH. sapiens (human)
-
Entrez GeneMRPS26 (a.k.a. C20orf193, GI008, MRP-S13, MRP-S26, MRPS13, NY-BR-87, RPMS13, dJ534B8.3, mS26)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer AGATAATTAGAATTAATTTGACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-U6gRNA5(MRPS26(12))-PGKpuro2ABFP-W was a gift from Kosuke Yusa (Addgene plasmid # 200498 ; http://n2t.net/addgene:200498 ; RRID:Addgene_200498) -
For your References section:
Canonical BAF complex regulates the oncogenic program in human T-cell acute lymphoblastic leukemia. Aoki K, Hyuga M, Tarumoto Y, Nishibuchi G, Ueda A, Ochi Y, Sugino S, Mikami T, Kobushi H, Kato I, Akahane K, Inukai T, Takaori-Kondo A, Takita J, Ogawa S, Yusa K. Blood. 2023 Nov 3:blood.2023020857. doi: 10.1182/blood.2023020857. 10.1182/blood.2023020857 PubMed 37922452