Skip to main content

pJS506
(Plasmid #200712)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200712 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pICH41295
  • Backbone manufacturer
    Sylvestre Marillonnet
  • Backbone size w/o insert (bp) 2243
  • Total vector size (bp) 3251
  • Vector type
    Synthetic Biology ; Modular cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PMA1 promoter
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1008
  • Mutation
    domesticated for MoClo cloning (removal of internal BpiI or BsaI sites)
  • Entrez Gene
    PMA1 (a.k.a. YGL008C, KTI10)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer gctcacatgttctttcctgc
  • 3′ sequencing primer GCC ACC TGA CGT CTA AGA AAC C
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJS506 was a gift from Jens Boch (Addgene plasmid # 200712 ; http://n2t.net/addgene:200712 ; RRID:Addgene_200712)
  • For your References section:

    Functional Analysis of Plant Monosaccharide Transporters Using a Simple Growth Complementation Assay in Yeast. Fuhrmeister R, Streubel J. Bio Protoc. 2023 Aug 5;13(15):e4733. doi: 10.21769/BioProtoc.4733. eCollection 2023 Aug 5. 10.21769/BioProtoc.4733 PubMed 37575400