pJS506
(Plasmid
#200712)
-
PurposePromoter region from ATPase PMA1 as Pro5U promoter module for heterologous expression of plasma membrane localized transporters in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepICH41295
-
Backbone manufacturerSylvestre Marillonnet
- Backbone size w/o insert (bp) 2243
- Total vector size (bp) 3251
-
Vector typeSynthetic Biology ; Modular cloning
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePMA1 promoter
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1008
-
Mutationdomesticated for MoClo cloning (removal of internal BpiI or BsaI sites)
-
Entrez GenePMA1 (a.k.a. YGL008C, KTI10)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer gctcacatgttctttcctgc
- 3′ sequencing primer GCC ACC TGA CGT CTA AGA AAC C (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJS506 was a gift from Jens Boch (Addgene plasmid # 200712 ; http://n2t.net/addgene:200712 ; RRID:Addgene_200712) -
For your References section:
Functional Analysis of Plant Monosaccharide Transporters Using a Simple Growth Complementation Assay in Yeast. Fuhrmeister R, Streubel J. Bio Protoc. 2023 Aug 5;13(15):e4733. doi: 10.21769/BioProtoc.4733. eCollection 2023 Aug 5. 10.21769/BioProtoc.4733 PubMed 37575400