RS314-U6(PolII-Lsm)
(Plasmid
#200772)
-
PurposePol II expression of U6 Lsm
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200772 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS314
-
Backbone manufacturerATCC
- Backbone size w/o insert (bp) 4783
- Total vector size (bp) 6045
-
Modifications to backboneThe WT U6 is driven by a GAL1 promoter, U6 coding sequence is inserted between SNR14(-100/-1) and SNR14(+296/+701), in the pRS314 vector
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGal-SNR6-II
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1262
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CCGCTCGAGATCATATTACATGGCATTACCA
- 3′ sequencing primer CGGGGTACCTTCCTCTCTGCTGTTTTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RS314-U6(PolII-Lsm) was a gift from Aaron Hoskins (Addgene plasmid # 200772 ; http://n2t.net/addgene:200772 ; RRID:Addgene_200772) -
For your References section:
Yeast U6 snRNA made by RNA polymerase II is less stable but functional. Lipinski KA, Chi J, Chen X, Hoskins AA, Brow DA. RNA. 2022 Dec;28(12):1606-1620. doi: 10.1261/rna.079328.122. Epub 2022 Oct 4. 10.1261/rna.079328.122 PubMed 36195346