CLIPf-KIF5A(1-914; Δ505-610)-SNAPf-HisTag-FLAG
(Plasmid
#200793)
-
PurposeMammalian expression of CLIPf-KIF5A(1-914; Δ505-610)-SNAPf-HisTag-FLAG
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCLAP
- Backbone size w/o insert (bp) 6558
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKIF5A
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2424
-
Mutation1-914; Δ505-610
-
Entrez GeneKif5a (a.k.a. D10Bwg0738e, Khc, Kif5, Kns, mKIAA4086)
- Promoter CMV & T7
-
Tags
/ Fusion Proteins
- CLIPf (N terminal on backbone)
- SNAPf, HisTag, FLAG (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGCGAGTCTCACCTGGCC
- 3′ sequencing primer TGCAGCCAGGTGGCTGTAGGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.20.629623 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CLIPf-KIF5A(1-914; Δ505-610)-SNAPf-HisTag-FLAG was a gift from Alison Twelvetrees (Addgene plasmid # 200793 ; http://n2t.net/addgene:200793 ; RRID:Addgene_200793) -
For your References section:
Kinesin-1 is highly flexible and adopts an open conformation in the absence of cargo. Smith ER, Turner ED, Abdelhamid MAS, Craggs TD, Twelvetrees AE. bioRxiv 2024.12.20.629623 10.1101/2024.12.20.629623