pAAV-U6-racRNA-B
(Plasmid
#200825)
-
PurposeAAV transfer plasmid encoding a circularized RNA barcode B under U6 promoter and a subcellular localization protein binder under hSyn promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200825 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-hSyn-mCherry
-
Backbone manufacturerAddgene plasmid #114472
- Backbone size w/o insert (bp) 4537
- Total vector size (bp) 6383
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameU6-racRNA
-
Alt namesequences encoding a circular RNA barcode under U6+27 promoter
-
SpeciesSynthetic
-
Insert Size (bp)614
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameV5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
-
Alt nameV5 tagged PP7 coating protein (PP7cp) fused with mouse HNRNPA1 M9 domain and a nuclear export signal;
-
Alt nameFlag tagged PP7 coating protein (PP7cp) fused with farnesylation motif
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)1252
- Promoter hSyn
-
Tags
/ Fusion Proteins
- V5 (N terminal on insert)
- Flag
- C-Far (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TCGTGTCGTGCCTGAGAGCG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySequences encoding the circular RNA downstream of a U6+27 promoter (U6+27-pre-racRNA) were adopted from the Tornado system (Addgene plasmid #124362, PubMed 30962542).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.06.20.496914v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-U6-racRNA-B was a gift from Xiao Wang (Addgene plasmid # 200825 ; http://n2t.net/addgene:200825 ; RRID:Addgene_200825) -
For your References section:
Spatial atlas of the mouse central nervous system at molecular resolution. Shi H, He Y, Zhou Y, Huang J, Maher K, Wang B, Tang Z, Luo S, Tan P, Wu M, Lin Z, Ren J, Thapa Y, Tang X, Chan KY, Deverman BE, Shen H, Liu A, Liu J, Wang X. Nature. 2023 Oct;622(7983):552-561. doi: 10.1038/s41586-023-06569-5. Epub 2023 Sep 27. 10.1038/s41586-023-06569-5 PubMed 37758947