Skip to main content

pAAV-U6-racRNA-D
(Plasmid #200827)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200827 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-hSyn-mCherry
  • Backbone manufacturer
    Addgene plasmid #114472
  • Backbone size w/o insert (bp) 4537
  • Total vector size (bp) 6383
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    U6-racRNA
  • Alt name
    sequences encoding a circular RNA barcode under U6+27 promoter
  • Species
    Synthetic
  • Insert Size (bp)
    614

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
  • Alt name
    V5 tagged PP7 coating protein (PP7cp) fused with mouse HNRNPA1 M9 domain and a nuclear export signal;
  • Alt name
    Flag tagged PP7 coating protein (PP7cp) fused with farnesylation motif
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    1252
  • Promoter hSyn
  • Tags / Fusion Proteins
    • V5 (N terminal on insert)
    • Flag
    • C-Far (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCGTGTCGTGCCTGAGAGCG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Sequences encoding the circular RNA downstream of a U6+27 promoter (U6+27-pre-racRNA) were adopted from the Tornado system (Addgene plasmid #124362, PubMed 30962542).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-U6-racRNA-D was a gift from Xiao Wang (Addgene plasmid # 200827 ; http://n2t.net/addgene:200827 ; RRID:Addgene_200827)
  • For your References section:

    Spatial atlas of the mouse central nervous system at molecular resolution. Shi H, He Y, Zhou Y, Huang J, Maher K, Wang B, Tang Z, Luo S, Tan P, Wu M, Lin Z, Ren J, Thapa Y, Tang X, Chan KY, Deverman BE, Shen H, Liu A, Liu J, Wang X. Nature. 2023 Oct;622(7983):552-561. doi: 10.1038/s41586-023-06569-5. Epub 2023 Sep 27. 10.1038/s41586-023-06569-5 PubMed 37758947