Skip to main content

AAV-CamKII-TRPV1-P2A-mCherry
(Plasmid #200829)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200829 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV-CamKII-TRPV1-P2A-DsRed
  • Backbone size w/o insert (bp) 4400
  • Total vector size (bp) 7698
  • Modifications to backbone
    Yes
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRPV1-P2A-mCherry
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3300
  • Entrez Gene
    Trpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
  • Promoter CamKII

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGGTTCTCCGTTTGCACTCAG
  • 3′ sequencing primer GTTGTTAACTTGTTTATTGCAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CamKII-TRPV1-P2A-mCherry was a gift from Hong Chen (Addgene plasmid # 200829 ; http://n2t.net/addgene:200829 ; RRID:Addgene_200829)
  • For your References section:

    Sonothermogenetics for noninvasive and cell-type specific deep brain neuromodulation. Yang Y, Pacia CP, Ye D, Zhu L, Baek H, Yue Y, Yuan J, Miller MJ, Cui J, Culver JP, Bruchas MR, Chen H. Brain Stimul. 2021 Jul-Aug;14(4):790-800. doi: 10.1016/j.brs.2021.04.021. Epub 2021 May 11. 10.1016/j.brs.2021.04.021 PubMed 33989819