pYG205
(Plasmid
#200836)
-
PurposeTranscribes rapZ from the arabinose-inducible PBAD promoter; RapZ directs RNase E to cleave fusion RNAs transcribed from pYG215 or derivatives
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200836 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 5096
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)E. coli TOP10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerapZ
-
Alt nameyhbJ
-
SpeciesEscherichia coli str. K-12 substr. MG1655
-
Insert Size (bp)855
-
Entrez GenerapZ (a.k.a. b3205, ECK3194, yhbJ)
- Promoter P-BAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer agattagcggatcctacctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYG205 was a gift from Boris Görke (Addgene plasmid # 200836 ; http://n2t.net/addgene:200836 ; RRID:Addgene_200836) -
For your References section:
Role of the 5' end phosphorylation state for small RNA stability and target RNA regulation in bacteria. Schilder A, Gorke B. Nucleic Acids Res. 2023 Mar 29:gkad226. doi: 10.1093/nar/gkad226. 10.1093/nar/gkad226 PubMed 36987877